Sequence ID | >W1510564314 |
Genome ID | CTFN01000046 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas aeruginosa [CTFN] |
Start position on genome | 22099 |
End posion on genome | 22023 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgcgccactc |
tRNA gene sequence |
GGCTACATAGCTCAGTCGGTTAGAGCGCAGCATTCATAATGCTGATGTCCCAGGTTCAAG |
Downstream region at tRNA end position |
tatttttcaa |
Secondary structure (Cloverleaf model) | >W1510564314 Met CAT c ACCA tatttttcaa G - C G - C C - G T - A A - T C - G A - T T G T G G C C C A T G A A | | | | A C C T C G C C A G G C G | | | | T T G G A G C T T A G ATGTC C - G A - T G - C C - G A - T T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |