Sequence ID | >W1510569964 |
Genome ID | CTIP01000006 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Yersinia enterocolitica YE221/02 [CTIP] |
Start position on genome | 33972 |
End posion on genome | 34048 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gtttttcaat |
tRNA gene sequence |
GCGTTCTTAGCTCAGTTGGTTAGAGCACCACCTTGACATGGTGGGGGTCGATGGTTCGAG |
Downstream region at tRNA end position |
atcttattat |
Secondary structure (Cloverleaf model) | >W1510569964 Val GAC t ACCA atcttattat G - C C - G G - C T - A T + G C - G T C T G T T T A C C A T G A A + | | | | G T C T C G G A T G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |