Sequence ID | >W11103801 |
Genome ID | ACRE01000080 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Actinomyces viscosus C505 [ACRE] |
Start position on genome | 132446 |
End posion on genome | 132373 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
actgtcatat |
tRNA gene sequence |
GCCCCCATCGTTTAGTGGCCTAGGACACCGCCCTCTCACGGCGGCGGCGCCGGTTCGAAT |
Downstream region at tRNA end position |
atcaagcagt |
Secondary structure (Cloverleaf model) | >W11103801 Glu CTC t ACgg atcaagcagt G + T C - G C - G C - G C - G C - G A - T T A T C G G C C A T G A C | | | | | G G T T T G G C C G G C G + + | | T T C G G A C C T A A CGGC C - G C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |