Sequence ID | >W1510578555 |
Genome ID | CTNI01000004 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Salmonella enterica subsp. enterica serovar Typhimurium str. DT104 V80 [CTNI] |
Start position on genome | 92912 |
End posion on genome | 92986 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gtacgacaat |
tRNA gene sequence |
TGGGGTATCGCCAAGCGGTAAGGCACCGGATTCTGATTCCGGCATTCCGAGGTTCGAATC |
Downstream region at tRNA end position |
cctttaaaaa |
Secondary structure (Cloverleaf model) | >W1510578555 Gln CTG t GCCA cctttaaaaa T - A G - C G - C G - C G - C T - A A - T T A T G C T C C A G A C | | | | | G C A C C G C G A G G C G | | | T T G A G G C T A A CATTC C - G C - G G - C G - C A - T T T T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |