Sequence ID | >C11106001 |
Genome ID | CP002924 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium pseudotuberculosis PAT10 [CP002924] |
Start position on genome | 2121853 |
End posion on genome | 2121926 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ttagcagtat |
tRNA gene sequence |
GCCGATGTAGTTCAATGGTAGAACATCAGCTTCCCAAGCTGAATACGCGGGTTCGATTCC |
Downstream region at tRNA end position |
ttttttgcgt |
Secondary structure (Cloverleaf model) | >C11106001 Gly CCC t TCCA ttttttgcgt G - C C - G C - G G - C A - T T - A G - C T T T T G C C C A A A A + | | | | G T C T T G G C G G G C G | | | | T T G G A A C T A A ATAC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |