| Sequence ID | >W1510606067 |
| Genome ID | CUJS01000011 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter jejuni OXC6255 [CUJS] |
| Start position on genome | 53713 |
| End posion on genome | 53638 |
| Amino Acid | Ala |
| Anticodon | GGC |
| Upstream region at tRNA start position |
aacttcattt |
| tRNA gene sequence |
GGGGCATTAGCTCAGCTGGGAGAGCACAACGCTGGCAGCGTTGGGGTCAGCGGTTCGAAC |
| Downstream region at tRNA end position |
tatggttccg |
| Secondary structure (Cloverleaf model) | >W1510606067 Ala GGC
t ACCA tatggttccg
G - C
G - C
G + T
G - C
C - G
A - T
T - A C A
T T C G C C A
C G A A | | | | | G
T C T C G A G C G G C
G | | | | T T
G G A G C
G A A GGGTC
C - G
A - T
A - T
C - G
G - C
C G
T A
G G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |