| Sequence ID | >W1510608120 |
| Genome ID | CULS01000001 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter jejuni OXC6364 [CULS] |
| Start position on genome | 364949 |
| End posion on genome | 365024 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
ccattataaa |
| tRNA gene sequence |
GGTCGCTTAGCTCAGTTGGTAGAGCGCCACCCTTACAAGGTGGATGTCATAAGTTCGAGT |
| Downstream region at tRNA end position |
ttttataaaa |
| Secondary structure (Cloverleaf model) | >W1510608120 Val TAC
a ACCA ttttataaaa
G - C
G - C
T - A
C - G
G + T
C - G
T - A T G
T T A T T C A
T G A A | | | | | G
T C T C G A T A A G C
G | | | | T T
G G A G C
T A G ATGTC
C - G
C - G
A - T
C - G
C - G
C A
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |