Sequence ID | >W1510613552 |
Genome ID | CUQX01000001 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Campylobacter jejuni OXC6503 [CUQX] |
Start position on genome | 29350 |
End posion on genome | 29274 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
caacttaggc |
tRNA gene sequence |
GGATTTATAGCTCAGTTGGTTAGAGCAACCGGCTCATAACCGGTTGGTCGCAGGTTCGAG |
Downstream region at tRNA end position |
ttctacatat |
Secondary structure (Cloverleaf model) | >W1510613552 Met CAT c ACCA ttctacatat G - C G - C A - T T - A T - A T - A A - T T G T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C T T A A TGGTC A - T C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |