| Sequence ID | >W1510614066 |
| Genome ID | CURK01000001 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter jejuni OXC6515 [CURK] |
| Start position on genome | 208855 |
| End posion on genome | 208931 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
cccgctttct |
| tRNA gene sequence |
GTCCTCGTAGCTCAGCAGGATAGAGCGCAAAATTCCTAATTTTGAGGCCGTGAGTTCGAA |
| Downstream region at tRNA end position |
ttttatgagg |
| Secondary structure (Cloverleaf model) | >W1510614066 Arg CCT
t ACCA ttttatgagg
G - C
T - A
C - G
C - G
T T
C - G
G - C T A
T C G C T C A
C G A A | + | | | G
A C T C G G T G A G C
G | | | | T T
G G A G C
A T A G AGGCC
C - G
A - T
A - T
A - T
A - T
T A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |