Sequence ID | >W1510615349 |
Genome ID | CUSQ01000001 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Campylobacter jejuni OXC6554 [CUSQ] |
Start position on genome | 165192 |
End posion on genome | 165266 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aaatatttat |
tRNA gene sequence |
TGGGGTATCGCCAAGCGGTAAGGCAACAGGTTTTGGTCCTGTCATTCAGGGGTTCGAATC |
Downstream region at tRNA end position |
cttcttattt |
Secondary structure (Cloverleaf model) | >W1510615349 Gln TTG t TCCA cttcttattt T - A G - C G - C G - C G - C T - A A - T T A T T T C C C A G A C | + | | | G C A C C G A G G G G C G | | | T T G A G G C T A A CATTC A - T C - G A - T G - C G - C T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |