Sequence ID | >W1510619310 |
Genome ID | CUWI01000001 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacterium tuberculosis BCG Frappier [CUWI] |
Start position on genome | 996199 |
End posion on genome | 996124 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gagtcttcgc |
tRNA gene sequence |
GCCCCTATAGCTCAGTTGGTAGAGCTACGGACTTTTAATCCGCAGGTCCCAGGTTCGAGT |
Downstream region at tRNA end position |
acaggggcac |
Secondary structure (Cloverleaf model) | >W1510619310 Lys TTT c ACAA acaggggcac G - C C - G C - G C - G C - G T + G A - T T G T G G T C C A T G A A | | | | | G T C T C G C C A G G C G | | | | T T G G A G C T A T AGGTC A C C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |