Sequence ID | >WENV039572 |
Genome ID | AACY022019708 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 87 |
End posion on genome | 11 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
aaaaattaaa |
tRNA gene sequence |
GGGCATGTAGCTCAGTTGGATAGAGCATCAGATTCCGGTTCTGAGAGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
aatgatttta |
Secondary structure (Cloverleaf model) | >WENV039572 Arg CCG a GTAA aatgatttta G - C G + T G - C C - G A - T T - A G - C T A T C T C C C A T G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A GAGTC T - A C - G A - T G - C A - T T T T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |