Sequence ID | >W1510651674 |
Genome ID | CVSY01000197 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Prochlorococcus marinus SCGC AAA795-I15 [CVSY] |
Start position on genome | 17805 |
End posion on genome | 17890 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aaattccaga |
tRNA gene sequence |
GGGAGTGTGGCGGAATTGGTAGACGCGCCGGACTTAAAATCCGTCGAGCGATTTAGCTCG |
Downstream region at tRNA end position |
tttaattatt |
Secondary structure (Cloverleaf model) | >W1510651674 Leu TAA a Attt tttaattatt G - C G - C G - C A - T G - C T - A G - C T G T C C C C C A T A A G | | | | | A T G G C G G G G G G C G | | | T T G A C G C T A G G CGAGCGATTTAGCTCGT C T C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |