Sequence ID | >W1510651710 |
Genome ID | CVSZ01000076 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Prochlorococcus marinus SCGC AAA795-M23 [CVSZ] |
Start position on genome | 11062 |
End posion on genome | 10988 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ttatctaaaT |
tRNA gene sequence |
GCGTCGTTAGTTCAGTTGGTAGAACGCAGGTCTCCAAAACCTGATGTCGGGGGTTCAAGT |
Downstream region at tRNA end position |
gatcaacatt |
Secondary structure (Cloverleaf model) | >W1510651710 Trp CCA T GTtt gatcaacatt G - C C - G G - C T - A C - G G - C T - A T G T C C T C C A T G A A | | + | | A T C T T G G G G G G C G | | | | T T G G A A C T A G ATGTC C - G A - T G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |