Sequence ID | >W1510654598 |
Genome ID | CVVX01000289 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas aeruginosa P27_Wales_1_VIM_2_02_11 [CVVX] |
Start position on genome | 4405 |
End posion on genome | 4480 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tccgggccgc |
tRNA gene sequence |
GTCCCCTTCGTCTAGTGGCCTAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAGT |
Downstream region at tRNA end position |
ttgcgggaat |
Secondary structure (Cloverleaf model) | >W1510654598 Glu TTC c GCCA ttgcgggaat G - C T - A C - G C - G C - G C - G T - A T G T T C C C C A T G A C | | | | | G G T C T G A G G G G C G + | | | T T C G G A C C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |