Sequence ID | >C11109378 |
Genome ID | CP002801 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Candidatus Protofrankia datiscae Dg1 [CP002801] |
Start position on genome | 4383928 |
End posion on genome | 4383855 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
aagaacagtt |
tRNA gene sequence |
GGCCCCGTCGTCTAGTGGCCTAGGACGCCGCCCTCTCAAGGCGGTAGCGCCGGTTCGAAT |
Downstream region at tRNA end position |
agataagacc |
Secondary structure (Cloverleaf model) | >C11109378 Glu CTC t ACgt agataagacc G + T G - C C - G C - G C - G C - G G - C T A T T G G C C A T G A C + | | | | G G T C T G G C C G G C G + | | | T T C G G A C C T A G TAGC C - G C - G G - C C - G C - G C A T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |