Sequence ID | >W11109169 |
Genome ID | ACYW01000040 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium jeikeium ATCC 43734 [ACYW] |
Start position on genome | 348 |
End posion on genome | 423 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
cgttgtgtat |
tRNA gene sequence |
GCGGATGTAGCGCAGTTGGTAGCGCATCACCTTGCCAAGGTGAGGGTCGCGAGTTCGAGT |
Downstream region at tRNA end position |
agctcaagca |
Secondary structure (Cloverleaf model) | >W11109169 Gly GCC t TCCA agctcaagca G - C C - G G - C G - C A - T T - A G - C T G T T G C T C A T G A A + | | | | G T C G C G G C G A G C G | | | | T T G G C G C T A A GGGTC T - A C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |