Sequence ID | >W1510668131 |
Genome ID | CWIU01000030 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Yersinia enterocolitica Y127 [CWIU] |
Start position on genome | 17984 |
End posion on genome | 17897 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cccgctcatt |
tRNA gene sequence |
GGAAGGATGGCCGAGTGGTTTAAGGCAACGGTCTTGAAAACCGTCGACTGTAACAGGTCC |
Downstream region at tRNA end position |
aattacgccg |
Secondary structure (Cloverleaf model) | >W1510668131 Ser TGA t GCCA aattacgccg G - C G - C A - T A - T G - C G - C A - T T A T A T C T C A T G A G | | | | | G G G C C G T A G A G C G | | | T T T A G G C T T A A CGACTGTAACAGGTCC A - T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |