| Sequence ID | >C11111521 |
| Genome ID | CP002281 |
| Phylum/Class | Fusobacteriota |
| Species | Ilyobacter polytropus DSM 2926 [CP002281] |
| Start position on genome | 2009806 |
| End posion on genome | 2009730 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
tatacctaat |
| tRNA gene sequence |
GGGGGTGTAGCTCAGATGGTTAGAGCACCGGCCTGTCACGCCGGGGGTCGCGAGTTCGAG |
| Downstream region at tRNA end position |
ttatttgaac |
| Secondary structure (Cloverleaf model) | >C11111521 Asp GTC
t GCCA ttatttgaac
G - C
G - C
G - C
G + T
G - C
T - A
G - C T G
T T G C T C A
A G A A + | | | | G
T C T C G G C G A G C
G | | | | T T
G G A G C
T T A A GGGTC
C - G
C - G
G - C
G - C
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |