Sequence ID | >W1510720166 |
Genome ID | CXOO01000062 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Limnohabitans sp. DM1 [CXOO] |
Start position on genome | 64492 |
End posion on genome | 64417 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
catctctacg |
tRNA gene sequence |
GTGGCTGTAGCTCAGTTGGTAGAGTCCAGGATTGTGATTCCTGTTGTCGTGGGTTCGAGC |
Downstream region at tRNA end position |
aattaaaaaa |
Secondary structure (Cloverleaf model) | >W1510720166 His GTG g CCCA aattaaaaaa G - C T - A G - C G - C C - G T - A G - C C G T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | + T T G G A G T T A C TTGTC C - G A - T G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |