Sequence ID | >W1510725106 |
Genome ID | CXYU01000016 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridiales bacterium mt11 [CXYU] |
Start position on genome | 27286 |
End posion on genome | 27372 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
agttaattat |
tRNA gene sequence |
GCCGAAGTGGTGGAACTGGCAGACGCGCTGGACTCAAAATCCTGTGGTAGCAATACCGTG |
Downstream region at tRNA end position |
tatctactcg |
Secondary structure (Cloverleaf model) | >W1510725106 Leu CAA t ACCA tatctactcg G - C C - G C - G G - C A - T A - T G - C T T T C G C C C A C A A G | | | | | G T G G T G G C G G G C G | + | T T G A C G C C A G G TGGTAGCAATACCGT C - G T T G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |