Sequence ID | >W1510741567 |
Genome ID | CYHS01000079 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Bacillus subtilis [CYHS] |
Start position on genome | 337 |
End posion on genome | 420 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgtaaaactT |
tRNA gene sequence |
GCCGGTGTGGCGGAATTGGCAGACGCGCACGACTCAAAATCGTGTTCCTTCTGGAGTGTC |
Downstream region at tRNA end position |
tgaaaaaccc |
Secondary structure (Cloverleaf model) | >W1510741567 Leu CAA T ATac tgaaaaaccc G + T C - G C - G G - C G - C T - A G - C C C T C A G C C A T A A G | | | | | G T G G C G G T C G G C G | | | T T G A C G C C A G G TTCCTTCTGGAGT C - G A - T C - G G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |