Sequence ID | >W1510757044 |
Genome ID | JACU01000008 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Novosphingobium barchaimii LL02 [JACU] |
Start position on genome | 80652 |
End posion on genome | 80725 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tgcttgaaac |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGCAGAGCAGAAGCTTCCCAAGCTTACGACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
taaattaaac |
Secondary structure (Cloverleaf model) | >W1510757044 Gly CCC c TCCA taaattaaac G - C C - G G - C G - C G - C T - A G - C T T T T T C C C A A A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C C A A CGAC G A A - T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |