Sequence ID | >W1510762845 |
Genome ID | JAIQ01000129 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Aliarcobacter butzleri L348 [JAIQ] |
Start position on genome | 1719 |
End posion on genome | 1794 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
agtccaaatt |
tRNA gene sequence |
AGGTCAGTAGCTCCAATGGTAGAGCGCCGGATTCCAAATCCGATGGTTGTGGGTTCGAAT |
Downstream region at tRNA end position |
ctaaattttt |
Secondary structure (Cloverleaf model) | >W1510762845 Trp CCA t GCCA ctaaattttt A - T G - C G - C T + G C - G A - T G - C T A T C C C C C A A A C A | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A G TGGTT C A C - G G - C G - C A - T T A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |