Sequence ID | >W1511185984 |
Genome ID | JMEM01000014 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Rhodococcus fascians LMG 3625 [JMEM] |
Start position on genome | 626771 |
End posion on genome | 626847 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aaagacgcca |
tRNA gene sequence |
GCCCTCGTATCCCAATTGGCAGAGGAAACGGATTCAAAACCCGTCCAGTGTGAGTTCGAG |
Downstream region at tRNA end position |
cagcagccca |
Secondary structure (Cloverleaf model) | >W1511185984 Leu CAA a ACCA cagcagccca G - C C - G C - G C - G T - A C - G G - C T G T C A C T C A T A A A | | | | | G T C C C T G T G A G C G | | | T T G A G G A C A G A CCAGT A - T C - G G - C G - C A C T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |