Sequence ID | >W1511298401 |
Genome ID | JPFJ01000075 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Rhizobium sp. H41 [JPFJ] |
Start position on genome | 648 |
End posion on genome | 572 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tttcccctgt |
tRNA gene sequence |
GGCGGGGTAGCTCAGGTGGTTAGAGCAGCGGAATCATAATCCGCGTGTCGGGGGTTCAAG |
Downstream region at tRNA end position |
cttttcttca |
Secondary structure (Cloverleaf model) | >W1511298401 Met CAT t ACCA cttttcttca G + T G - C C - G G - C G - C G - C G + T T G T C T C C C A G G A A | + | | | A T C T C G G G G G G C G | | | | T T G G A G C T T A A GTGTC G - C C - G G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |