Sequence ID | >W1511303358 |
Genome ID | JPJJ01000001 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Rhodococcus sp. p52 [JPJJ] |
Start position on genome | 116635 |
End posion on genome | 116560 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tcggcaccga |
tRNA gene sequence |
GGCGGTGTAGCTCAGTTGGTAGAGCAAACGACTCATAATCGTTGCGTCGCCGGTTCAAGT |
Downstream region at tRNA end position |
aaagttcatt |
Secondary structure (Cloverleaf model) | >W1511303358 Met CAT a ACCA aaagttcatt G + T G - C C - G G - C G - C T - A G - C T G T T G G C C A T G A A + | | | | A T C T C G G C C G G C G | | | | T T G G A G C T A A GCGTC A - T A - T C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |