| Sequence ID | >W11116266 |
| Genome ID | ADFP01000088 |
| Phylum/Class | Synergistota |
| Species | Pyramidobacter piscolens W5455 [ADFP] |
| Start position on genome | 136 |
| End posion on genome | 61 |
| Amino Acid | Ala |
| Anticodon | TGC |
| Upstream region at tRNA start position |
catttttgct |
| tRNA gene sequence |
GGGGGTGTAGCTCAGTTGGGAGAGCGCCTGCTTTGCACGCAGGAGGTCGTCGGTTCGATT |
| Downstream region at tRNA end position |
gcataagaac |
| Secondary structure (Cloverleaf model) | >W11116266 Ala TGC
t ACCA gcataagaac
G - C
G - C
G + T
G - C
G - C
T - A
G - C T T
T T G G C C A
T G A A + + | | | G
T C T C G G T C G G C
G | | | | T T
G G A G C
G A G AGGTC
C - G
C - G
T - A
G - C
C - G
T C
T A
T G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |