Sequence ID | >W1511305105 |
Genome ID | JPLB01000029 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Luteibacter rhizovicinus DSM 16549 [JPLB] |
Start position on genome | 5171 |
End posion on genome | 5260 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
agaaaaatac |
tRNA gene sequence |
GGAGAGATGGCCGAGTGGTTTAAGGCAGCAGTCTTGAAAACTGCCGTAGGTGTGAGCCTA |
Downstream region at tRNA end position |
aaatcgtgga |
Secondary structure (Cloverleaf model) | >W1511305105 Ser TGA c GCCA aaatcgtgga G - C G - C A - T G - C A - T G - C A - T T A T C A C C C A T G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C T T A A CGTAGGTGTGAGCCTACC G - C C - G A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |