Sequence ID | >W11116800 |
Genome ID | ADGF01000002 |
Search identical group | |
Phylum/Class | Fusobacteriota |
Species | Fusobacterium vincentii 3_1_27 [ADGF] |
Start position on genome | 18324 |
End posion on genome | 18247 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cattatatgt |
tRNA gene sequence |
GGATCCATAGCTCAGTTTGGTCAGAGCACTCGGCTCATAACCGAGTGGTCGCTGGTTCGA |
Downstream region at tRNA end position |
ttttttttgt |
Secondary structure (Cloverleaf model) | >W11116800 Met CAT t ACCA ttttttttgt G - C G - C A - T T - A C - G C - G A - T T G T C G A C C A T T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T C A A TGGTC C - G T - A C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |