Sequence ID | >W1511344001 |
Genome ID | JRFE01000052 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Myxosarcina sp. GI1 [JRFE] |
Start position on genome | 18007 |
End posion on genome | 18083 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tagaaacaaa |
tRNA gene sequence |
GGGCTATTAGCTCAGGTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCCCTGGTTCAAG |
Downstream region at tRNA end position |
ctaaattaag |
Secondary structure (Cloverleaf model) | >W1511344001 Ile GAT a ACCA ctaaattaag G - C G - C G - C C - G T + G A - T T - A T G T G G A C C A G G A A | | | | | A T C T C G C C T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |