Sequence ID | >W1511351906 |
Genome ID | JRNR01000052 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Prevotella disiens DNF00882 [JRNR] |
Start position on genome | 32593 |
End posion on genome | 32518 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
actatattct |
tRNA gene sequence |
ACGGGTTTAGCTCAGTTGGTAGAGCACTGGTCTCCAAAACCAGGTGTCGAGGGTTCGAGC |
Downstream region at tRNA end position |
aagaaagata |
Secondary structure (Cloverleaf model) | >W1511351906 Trp CCA t GCTA aagaaagata A - T C - G G - C G - C G - C T - A T - A C G T C T T C C A T G A A | | + | | G T C T C G G A G G G C G | | | | T T G G A G C T A A GTGTC C - G T - A G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |