Sequence ID | >W1511357585 |
Genome ID | JRWM01000006 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio variabilis T01 [JRWM] |
Start position on genome | 882 |
End posion on genome | 798 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
aggaatagat |
tRNA gene sequence |
GCGGAAGTGGCGGAATTGGTAGACGCACCAGATTTAGGTTCTGGCGCCGCAAGGTGTGAG |
Downstream region at tRNA end position |
tgttttatag |
Secondary structure (Cloverleaf model) | >W1511357585 Leu TAG t ACCA tgttttatag G - C C - G G - C G - C A - T A - T G - C T G T C T C T C A T A A G | | | | | A T G G C G G A G A G C G | | | T T G A C G C T A G A CGCCGCAAGGTGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |