| Sequence ID | >C11119137 |
| Genome ID | CP002271 |
| Phylum/Class | Myxococcota |
| Species | Stigmatella aurantiaca DW4/3-1 [CP002271] |
| Start position on genome | 6201492 |
| End posion on genome | 6201417 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
atgggtcaac |
| tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTAGAGCGTCAGCCTTCCAAGCTGAATGTCGTGGGTTCGAGT |
| Downstream region at tRNA end position |
acgcgttgtt |
| Secondary structure (Cloverleaf model) | >C11119137 Gly TCC
c TCCA acgcgttgtt
G - C
C - G
G - C
G - C
G - C
A - T
A - T T G
T T A C C C A
T G A A + | | | | G
T C T C G G T G G G C
G | | | | T T
G G A G C
T A G ATGTC
T - A
C - G
A - T
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |