Sequence ID | >W1511362251 |
Genome ID | JSCB01000071 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Proteus mirabilis Pm-Oxa48 [JSCB] |
Start position on genome | 1561 |
End posion on genome | 1486 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
acattgtgac |
tRNA gene sequence |
GGGTCGTTAGCTCAGTCGGTAGAGCAGTTGACTTTTAATCAATTGGTCGGGCGTTCGAGT |
Downstream region at tRNA end position |
ttcacaatac |
Secondary structure (Cloverleaf model) | >W1511362251 Lys TTT c ACCA ttcacaatac G - C G - C G - C T - A C - G G - C T - A T G T C C C G C A T G A A | | | | | G C C T C G G G G C G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |