Sequence ID | >W1511362860 |
Genome ID | JSCM01000036 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Acinetobacter baumannii 2004BJAB14 [JSCM] |
Start position on genome | 18923 |
End posion on genome | 18839 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tgtcccagat |
tRNA gene sequence |
GGGGGCGTGGCGAAATTGGTAGACGCACTGGATTTAGGTTCCAGCGCCGCAAGGTGTAAG |
Downstream region at tRNA end position |
tagaaagaag |
Secondary structure (Cloverleaf model) | >W1511362860 Leu TAG t ACCA tagaaagaag G - C G - C G - C G - C G - C C - G G - C T G T T T C T C A T A A G | | | | | G T A G C G A A G A G C G | | | T T G A C G C T A G A CGCCGCAAGGTGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |