Sequence ID | >W1511365332 |
Genome ID | JSDZ01000011 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium bifidum LMG 11583 [JSDZ] |
Start position on genome | 437601 |
End posion on genome | 437684 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tgccggcaca |
tRNA gene sequence |
GCCCCCGTGGCGGAATCGGTAGACGCAGCGGACTTAAAATCCGCCGCTTTTGGCTTGTGG |
Downstream region at tRNA end position |
tatcgcaaca |
Secondary structure (Cloverleaf model) | >W1511365332 Leu TAA a ACCT tatcgcaaca G - C C - G C - G C - G C - G C - G G - C T G T C A C C C A T A A G | | | | | G C G G C G G T G G G C G | | | T T G A C G C T A G A CGCTTTTGGCTT G - C C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |