Sequence ID | >W1511366950 |
Genome ID | JSFP01000117 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Streptomyces sp. CT34 [JSFP] |
Start position on genome | 85 |
End posion on genome | 160 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
accggtcttg |
tRNA gene sequence |
GTGGGTATAGCTCAGCTGGTAGAGCACCTGGTTGTGGTCCAGGATGTCGCGGGTTCGAGT |
Downstream region at tRNA end position |
gcagcaaggc |
Secondary structure (Cloverleaf model) | >W1511366950 His GTG g CCCA gcagcaaggc G - C T - A G - C G + T G - C T - A A - T T G T T G C C C A C G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A ATGTC C - G C - G T - A G - C G - C T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |