Sequence ID | >W1511381267 |
Genome ID | JSQV01000082 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli blood-09-1545 [JSQV] |
Start position on genome | 4983 |
End posion on genome | 4907 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tctcagcgtt |
tRNA gene sequence |
GTGGCATTAGCTCAGTTGGACAGAGCAACCGCCTTCTAAGCGGTTGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
gaatcacgcc |
Secondary structure (Cloverleaf model) | >W1511381267 Arg TCT t GCCA gaatcacgcc G - C T - A G - C G - C C - G A - T T - A T A T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A C A A TGGTC A - T C - G C - G G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |