The detailed information of tRNA gene sequence


Sequence ID>W1511387779
Genome IDJSVC01000024
Search identical group
Phylum/ClassBacteroidota
SpeciesFlavihumibacter solisilvae 33 [JSVC]
Start position on genome 98994
End posion on genome 99070
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
tgagggaaat
tRNA gene sequence
GGATCGGTAGTTCAGTTGGTTAGAATGCCGCCCTGTCACGGCGGAGGTCGCGGGTTCGAG
TCCCGTCCGGTCCGCAA
Downstream region at tRNA end position
aggctcactt
Secondary structure (Cloverleaf model)
>W1511387779	Asp	GTC
                   t      GCAA aggctcactt
                     G - C
                     G - C
                     A - T
                     T + G
                     C - G
                     G - C
                     G - C          T G
                    T     T G C C C     A
      T G A        A      + | | | |     G
    T       C T T G       G C G G G     C
    G       | | | +                 T T
    G       G A A T
      T T A        G     AGGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    C - G
                  C       C
                  T       A
                    G T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK