Sequence ID | >W1511388784 |
Genome ID | JSWJ01000023 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Phaeobacter sp. S60 [JSWJ] |
Start position on genome | 13229 |
End posion on genome | 13146 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aactgattgt |
tRNA gene sequence |
GGGCGACAGGCCGCAAGGTGTGGCAGGGGACTGTAACTCCCTCGCGGAGACGCACGCCTG |
Downstream region at tRNA end position |
tcttctctct |
Secondary structure (Cloverleaf model) | >W1511388784 Tyr GTA t ACCA tcttctctct G - C G - C G - C C - G G - C A - T C - G T T A G G A C C A A C G | | | | | G A G C C G C C T G G C G + | | | T T G T G G C T G A CGCGGAGACGCACG G + T G - C G - C G - C A - T C C T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |