| Sequence ID | >W1511390900 |
| Genome ID | JSYL01000010 |
| Phylum/Class | Bacteroidota |
| Species | Kaistella jeonii DSM 17048 [JSYL] |
| Start position on genome | 20154 |
| End posion on genome | 20082 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
ttaatttttc |
| tRNA gene sequence |
GCCGACTTAGCTCAGGGGTAGAGCGTTTCCTTGGTAAGGAAGAGGTCGTGAGTTCAAATC |
| Downstream region at tRNA end position |
tagaaatctc |
| Secondary structure (Cloverleaf model) | >W1511390900 Thr GGT
c TCtg tagaaatctc
G - C
C - G
C - G
G + T
A - T
C - G
T - A T A
T T A C T C A
G A A + | | | | A
G C T C G G T G A G C
G | | | | T T
G G A G C
T A G AGGTC
T + G
T - A
T - A
C - G
C - G
T A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |