Sequence ID | >W1511398680 |
Genome ID | JTDS01000027 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli GSK2522 [JTDS] |
Start position on genome | 47988 |
End posion on genome | 48064 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
gggccgctat |
tRNA gene sequence |
CCGCCACTGGCTCATCGGGAAAGAGCATCAGCCTTCTAAGTTGACTGTGCGAGGTTCGAG |
Downstream region at tRNA end position |
gtactgattt |
Secondary structure (Cloverleaf model) | >W1511398680 Arg TCT t TCCA gtactgattt C - G C - G G - C C - G C - G A - T C - G T G T G C T C C A C T A G | | | | | G G C T C G C G A G G C G | | | | T T G G A G C A A A A CTGTG T - A C - G A - T G + T C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |