Sequence ID | >C11121844 |
Genome ID | CP002637 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Selenomonas sputigena ATCC 35185 [CP002637] |
Start position on genome | 2177995 |
End posion on genome | 2177921 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ggcaaatcaa |
tRNA gene sequence |
GCGGAAGTAGCTCAGTGGTAGAGCACCACCTTGCCAAGGTGGGGGTCGCGAGTTCGAGCC |
Downstream region at tRNA end position |
tatatgcgga |
Secondary structure (Cloverleaf model) | >C11121844 Gly GCC a TCCA tatatgcgga G - C C - G G - C G - C A - T A - T G + T C G T T G C T C A G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A A GGGTC C - G C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |