Sequence ID | >C11122490 |
Genome ID | CP002466 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Thermoanaerobacter brockii subsp. finnii Ako-1 [CP002466] |
Start position on genome | 1826460 |
End posion on genome | 1826385 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tcactgatgt |
tRNA gene sequence |
CGGGATGTGGCGCAGTTGGTAGCGCACGTGCTTTGGGAGCATGGGGTCGGGGGTTCAAGT |
Downstream region at tRNA end position |
ttgtggtcgt |
Secondary structure (Cloverleaf model) | >C11122490 Pro TGG t ACCA ttgtggtcgt C - G G - C G - C G - C A - T T - A G - C T G T C T C C C A T G A G | + | | | A T C G C G G G G G G C G | | | | T T G G C G C T A A GGGTC C - G G + T T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |