Sequence ID | >W11121525 |
Genome ID | ADOE01000017 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Actinobacillus pleuropneumoniae serovar 2 str. S1536 [ADOE] |
Start position on genome | 11259 |
End posion on genome | 11174 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cagtataaaa |
tRNA gene sequence |
GCTCTGGTGGTGGAATTGGTAGACACGCTATCTTGAGGGGGTAGTGTCCATAGGATGTGC |
Downstream region at tRNA end position |
tatataaagc |
Secondary structure (Cloverleaf model) | >W11121525 Leu GAG a ACCA tatataaagc G - C C - G T - A C - G T - A G - C G - C T G T C G C T C A T A A G | | | | | G T G G T G G C G A G C G | | | T T G A C A C T A G G TGTCCATAGGATGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |