Sequence ID | >C11122968 |
Genome ID | CP001843 |
Search identical group | |
Phylum/Class | Spirochaetota |
Species | Treponema primitia ZAS-2 [CP001843] |
Start position on genome | 3517914 |
End posion on genome | 3517840 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ttcgtatcaT |
tRNA gene sequence |
TCCCCTGTAGCTCAGTTGGCAGAGCAAGTGGCTGTTAACCACTGGGTCCGTGGTTCAAAC |
Downstream region at tRNA end position |
atgtggcgtt |
Secondary structure (Cloverleaf model) | >C11122968 Asn GTT T GTaa atgtggcgtt T - A C - G C - G C - G C - G T + G G - C C A T G C G C C A T G A A | | + | | A T C T C G C G T G G C G | | | | T T G G A G C C A A GGGTC A - T G - C T - A G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |