Sequence ID | >C11123256 |
Genome ID | CP002991 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Thermoanaerobacter wiegelii Rt8.B1 [CP002991] |
Start position on genome | 2253423 |
End posion on genome | 2253338 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttaaaaatgt |
tRNA gene sequence |
GGAGGGATACCCAAGTGGCCAAAGGGGGCAGACTGTAAATCTGTTGGCTGTCGCCTTCGA |
Downstream region at tRNA end position |
tatgacccat |
Secondary structure (Cloverleaf model) | >C11123256 Tyr GTA t ACCA tatgacccat G - C G - C A - T G - C G - C G - C A - T T A T C T A C C A T G A A | | | | | A G A C C C G A T G G C G | | | T T C A G G G C A A G TGGCTGTCGCCTTC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |