Sequence ID | >C11123810 |
Genome ID | CP002455 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Weeksella virosa DSM 16922 [CP002455] |
Start position on genome | 1880676 |
End posion on genome | 1880752 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
agtagcattg |
tRNA gene sequence |
GGTCGCGTAGCTCAGCTGGATAGAGCATCTGCCTTCTAAGCAGACGGTCAGGGGTTCGAA |
Downstream region at tRNA end position |
agtaagaagc |
Secondary structure (Cloverleaf model) | >C11123810 Arg TCT g ACAA agtaagaagc G - C G + T T - A C - G G - C C - G G - C T A T T T C C C A C G A A | + | | | G T C T C G A G G G G C G | | | | T T G G A G C A T A A CGGTC T - A C - G T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |