Sequence ID | >W1511429982 |
Genome ID | JUEC02000137 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | [Pseudomonas] sp. BICA1-14 BICA1-14 [JUEC] |
Start position on genome | 36722 |
End posion on genome | 36811 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ccgtcgatcc |
tRNA gene sequence |
GGTGAGGTGTCCGAGCGGTTGAAGGAGCACGCCTGGAAAGTGTGTATACGAGAAATCGTA |
Downstream region at tRNA end position |
tattcgattc |
Secondary structure (Cloverleaf model) | >W1511429982 Ser GGA c GCCA tattcgattc G - C G - C T - A G - C A - T G - C G - C T A T T T C C C A C G A G | | | | | G G G C C T A A G G G C G | | | T T T A G G A T G A G TATACGAGAAATCGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |